pAAV-hSOX9-dTAG-mNeonGreen-V5
(Plasmid
#194971)
-
PurposeAAV vector for knocking in a C-terminal tag (dTAG-mNeonGreen-V5) for human SOX9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV helper vector
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6984
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSRY-box transcription factor 9
-
Alt nameSOX9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2894
-
Entrez GeneSOX9 (a.k.a. CMD1, CMPD1, ENH13, SRA1, SRXX2, SRXY10, TES, TESCO)
-
Tag
/ Fusion Protein
- dTAG-mNeonGreen-V5 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCACAGCCCTTGTTGATTTT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.06.13.495964v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSOX9-dTAG-mNeonGreen-V5 was a gift from Joanna Wysocka (Addgene plasmid # 194971 ; http://n2t.net/addgene:194971 ; RRID:Addgene_194971) -
For your References section:
Precise modulation of transcription factor levels identifies features underlying dosage sensitivity. Naqvi S, Kim S, Hoskens H, Matthews HS, Spritz RA, Klein OD, Hallgrimsson B, Swigut T, Claes P, Pritchard JK, Wysocka J. Nat Genet. 2023 May;55(5):841-851. doi: 10.1038/s41588-023-01366-2. Epub 2023 Apr 6. 10.1038/s41588-023-01366-2 PubMed 37024583