pAAV-CamKIIa-moxBFP-IRES-Flpo
(Plasmid
#194977)
-
PurposeAAV vector to drive expression of moxBFP and Flpo under the control of CamKIIalpha promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194977 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5345
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemoxBFP, Flpo
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
- 3′ sequencing primer GAATACCAGTCAATCTTTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CamKIIa-moxBFP-IRES-Flpo was a gift from Günter Schwarz (Addgene plasmid # 194977 ; http://n2t.net/addgene:194977 ; RRID:Addgene_194977) -
For your References section:
Automated Image Analysis Reveals Different Localization of Synaptic Gephyrin C4 Splice Variants. Liebsch F, Eggersmann FR, Merkler Y, Kloppenburg P, Schwarz G. eNeuro. 2023 Jan 4;10(1):ENEURO.0102-22.2022. doi: 10.1523/ENEURO.0102-22.2022. Print 2023 Jan. 10.1523/ENEURO.0102-22.2022 PubMed 36543537