Skip to main content

pAAV-CamKIIa-moxBFP-IRES-Flpo
(Plasmid #194977)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194977 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 5345
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    moxBFP, Flpo
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTCCTGCAGTATTGTGTAT
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CamKIIa-moxBFP-IRES-Flpo was a gift from Günter Schwarz (Addgene plasmid # 194977 ; http://n2t.net/addgene:194977 ; RRID:Addgene_194977)
  • For your References section:

    Automated Image Analysis Reveals Different Localization of Synaptic Gephyrin C4 Splice Variants. Liebsch F, Eggersmann FR, Merkler Y, Kloppenburg P, Schwarz G. eNeuro. 2023 Jan 4;10(1):ENEURO.0102-22.2022. doi: 10.1523/ENEURO.0102-22.2022. Print 2023 Jan. 10.1523/ENEURO.0102-22.2022 PubMed 36543537