pX459-sgRNA4-CTCF-3p-UTR
(Plasmid
#195106)
-
PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195106 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePX459 V2.0 Addgene plasmid #62988
- Total vector size (bp) 9178
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA against CTCF 3' UTR region
-
gRNA/shRNA sequenceGTTTTCGTTCTCGGTATGTT
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.07.29.454218v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX459-sgRNA4-CTCF-3p-UTR was a gift from Job Dekker (Addgene plasmid # 195106 ; http://n2t.net/addgene:195106 ; RRID:Addgene_195106) -
For your References section:
A cohesin traffic pattern genetically linked to gene regulation. Valton AL, Venev SV, Mair B, Khokhar ES, Tong AHY, Usaj M, Chan K, Pai AA, Moffat J, Dekker J. Nat Struct Mol Biol. 2022 Dec 8. doi: 10.1038/s41594-022-00890-9. 10.1038/s41594-022-00890-9 PubMed 36482254