Skip to main content

GFP-itis pBE-t
(Plasmid #195342)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195342 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    unknown
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    ecTadA(8e)-SpCas9-NG
  • Alt name
    ABE8e A to G base editor
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    4650
  • Mutation
    SpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F, A1322R, R1335V, T1337R
  • Promoter ProC

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    gRNA ctctacgcgggtcttgtagt
  • Promoter Lac

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-itis pBE-t was a gift from Alexis Komor (Addgene plasmid # 195342 ; http://n2t.net/addgene:195342 ; RRID:Addgene_195342)
  • For your References section:

    Curing "GFP-itis" in Bacteria with Base Editors: Development of a Genome Editing Science Program Implemented with High School Biology Students. Vasquez CA, Evanoff M, Ranzau BL, Gu S, Deters E, Komor AC. CRISPR J. 2023 Apr 20. doi: 10.1089/crispr.2023.0002. 10.1089/crispr.2023.0002 PubMed 37083425