pAAV-CNTF-HA
(Plasmid
#195517)
-
PurposeExpresses HA-tagged CNTF in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-MCS
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4650
- Total vector size (bp) 6052
-
Modifications to backboneRibeiro M, Ayupe AC, Beckedorff FC, Levay K, Rodriguez S, Tsoulfas P, Lee JK, Nascimento-dos-Santos G, Park KK. Retinal ganglion cell expression of cytokine enhances occupancy of NG2 cell-derived astrocytes at the nerve injury site: Implication for axon regeneration
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCiliary neurotrophic factor
-
Alt nameCNTF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)651
-
GenBank IDNM_000614.4
-
Entrez GeneCNTF (a.k.a. HCNTF)
- Promoter UbC promoter with beta-globin intron
-
Tags
/ Fusion Proteins
- NGF signal peptide (N terminal on insert)
- HA-tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer caacctggactctgcggatg
- 3′ sequencing primer catcccatccgcagagtcc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CNTF-HA was a gift from Kevin Park (Addgene plasmid # 195517 ; http://n2t.net/addgene:195517 ; RRID:Addgene_195517) -
For your References section:
Retinal ganglion cell expression of cytokine enhances occupancy of NG2 cell-derived astrocytes at the nerve injury site: Implication for axon regeneration. Ribeiro M, Ayupe AC, Beckedorff FC, Levay K, Rodriguez S, Tsoulfas P, Lee JK, Nascimento-Dos-Santos G, Park KK. Exp Neurol. 2022 Sep;355:114147. doi: 10.1016/j.expneurol.2022.114147. Epub 2022 Jun 20. 10.1016/j.expneurol.2022.114147 PubMed 35738417