pAAV-Bcl2
(Plasmid
#195551)
-
PurposeExpresses Bcl2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneModified pAAV-MCS
- Backbone size w/o insert (bp) 4626
- Total vector size (bp) 5371
-
Modifications to backboneinsertion of HA-tag
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBcl2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)711
-
GenBank IDNM_009741 12043
-
Entrez GeneBcl2 (a.k.a. Bcl-2, C430015F12Rik, D630044D05Rik, D830018M01Rik)
- Promoter CMV enhancer and promoter
-
Tag
/ Fusion Protein
- HA-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (destroyed during cloning)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer ATCTTCCTCCCACAGCTCCT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Bcl2 was a gift from Kevin Park (Addgene plasmid # 195551 ; http://n2t.net/addgene:195551 ; RRID:Addgene_195551) -
For your References section:
Thrombospondin-1 Mediates Axon Regeneration in Retinal Ganglion Cells. Bray ER, Yungher BJ, Levay K, Ribeiro M, Dvoryanchikov G, Ayupe AC, Thakor K, Marks V, Randolph M, Danzi MC, Schmidt TM, Chaudhari N, Lemmon VP, Hattar S, Park KK. Neuron. 2019 Aug 21;103(4):642-657.e7. doi: 10.1016/j.neuron.2019.05.044. Epub 2019 Jun 26. 10.1016/j.neuron.2019.05.044 PubMed 31255486