Skip to main content
Addgene

pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
(Plasmid #196082)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196082 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
  • Backbone manufacturer
    Czarnek et al., 2021
  • Total vector size (bp) 11264
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dCas9-KRAB-MeCP2 repressor
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    5313
  • Mutation
    Catalytically dead mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system (Cas9m4) fused with Krüppel-associated box (KRAB) transcriptional repression domain from the human zinc finger protein ZNF1 (Margolin et al., 1994) and transcriptional repression domain from rat methyl-CpG-binding protein 2 (Nan et al., 1997).

Gene/Insert 2

  • Gene/Insert name
    hU6 promoter and gRNA scaffold
  • Species
    H. sapiens (human); Streptococcus pyogenes
  • Insert Size (bp)
    343
  • Mutation
    hU6 promoter and gRNA scaffold containing SapI sites were amplified from pX330 containing SapI sites instead of BbsI sites (Czarnek et al., 2021).

Gene/Insert 3

  • Gene/Insert name
    Aminoglycoside phosphotransferase
  • Species
    E.coli
  • Insert Size (bp)
    399

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCTACTAACTTCAGCCTGCTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Plasmid contains a T99M mutation in HygR. This mutation is not expected to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI was a gift from Joanna Bereta (Addgene plasmid # 196082 ; http://n2t.net/addgene:196082 ; RRID:Addgene_196082)
  • For your References section:

    Construction of a Set of Novel Transposon Vectors for Efficient Silencing of Protein and lncRNA Genes via CRISPR Interference. Czarnek M, Kochan J, Wawro M, Myrczek R, Bereta J. Mol Biotechnol. 2023 Jan 28. doi: 10.1007/s12033-023-00675-5. 10.1007/s12033-023-00675-5 PubMed 36707469