pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
(Plasmid
#196082)
-
Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
-
Backbone manufacturerCzarnek et al., 2021
- Total vector size (bp) 11264
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedCas9-KRAB-MeCP2 repressor
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)5313
-
MutationCatalytically dead mutant of the Cas9 endonuclease from the Streptococcus pyogenes Type II CRISPR/Cas system (Cas9m4) fused with Krüppel-associated box (KRAB) transcriptional repression domain from the human zinc finger protein ZNF1 (Margolin et al., 1994) and transcriptional repression domain from rat methyl-CpG-binding protein 2 (Nan et al., 1997).
Gene/Insert 2
-
Gene/Insert namehU6 promoter and gRNA scaffold
-
SpeciesH. sapiens (human); Streptococcus pyogenes
-
Insert Size (bp)343
-
MutationhU6 promoter and gRNA scaffold containing SapI sites were amplified from pX330 containing SapI sites instead of BbsI sites (Czarnek et al., 2021).
Gene/Insert 3
-
Gene/Insert nameAminoglycoside phosphotransferase
-
SpeciesE.coli
-
Insert Size (bp)399
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTACTAACTTCAGCCTGCTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a T99M mutation in HygR. This mutation is not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI was a gift from Joanna Bereta (Addgene plasmid # 196082 ; http://n2t.net/addgene:196082 ; RRID:Addgene_196082) -
For your References section:
Construction of a Set of Novel Transposon Vectors for Efficient Silencing of Protein and lncRNA Genes via CRISPR Interference. Czarnek M, Kochan J, Wawro M, Myrczek R, Bereta J. Mol Biotechnol. 2023 Jan 28. doi: 10.1007/s12033-023-00675-5. 10.1007/s12033-023-00675-5 PubMed 36707469