pJR152
(Plasmid
#196280)
-
PurposeCassette used in dual sgRNA library generation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBA904 (Addgene #122238)
- Total vector size (bp) 8910
-
Modifications to backbonehU6-CR3 cassette cloned using XbaI/NotI
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehU6-sgRNA-CR3
-
gRNA/shRNA sequencegaccaggatgggcaccaccc
-
SpeciesSynthetic
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer hU6-F: gagggcctatttcccatgatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJR152 was a gift from Rebecca Voorhees (Addgene plasmid # 196280 ; http://n2t.net/addgene:196280 ; RRID:Addgene_196280) -
For your References section:
A dual sgRNA library design to probe genetic modifiers using genome-wide CRISPRi screens. Guna A, Page KR, Replogle JM, Esantsi TK, Wang ML, Weissman JS, Voorhees RM. BMC Genomics. 2023 Oct 30;24(1):651. doi: 10.1186/s12864-023-09754-y. 10.1186/s12864-023-09754-y PubMed 37904134