Skip to main content

AAV-GfaABC1D-lck-smV5-4x6T-WPRE
(Plasmid #196416)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196416 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-MCS
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 3406
  • Total vector size (bp) 6866
  • Modifications to backbone
    The GfaABC1D promoter and the 4x6T miRNA targeting cassette were added to confer astrocyte specificity.
  • Vector type
    Mammalian Expression, AAV ; Astrocyte-selective

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Lck-smV5
  • Alt name
    membrane targeted V5 spaghetti monster
  • Alt name
    smFP_V5
  • Species
    Synthetic
  • Insert Size (bp)
    1380
  • Promoter GfaABC1D
  • Tag / Fusion Protein
    • Lck (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tagcccactccttcataaag
  • 3′ sequencing primer ttattaggacaaggctggtg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    AAV-GfaABC1D-lck-smV5-4x6T was created using AAV pmSyn1-EBFP-Cre (Addgene 51507) provided by Hongkui Zeng and smV5 (Addgene 59758) provided by Loren Looger.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-GfaABC1D-lck-smV5-4x6T-WPRE was a gift from Stanley Thomas Carmichael (Addgene plasmid # 196416 ; http://n2t.net/addgene:196416 ; RRID:Addgene_196416)
  • For your References section:

    A toolbox of astrocyte-specific, serotype-independent adeno-associated viral vectors using microRNA targeting sequences. Gleichman AJ, Kawaguchi R, Sofroniew MV, Carmichael ST. Nat Commun. 2023 Nov 16;14(1):7426. doi: 10.1038/s41467-023-42746-w. 10.1038/s41467-023-42746-w PubMed 37973910