SBE-NLS-mCherry-P2A-CreERT2 PGK-rtTA3
(Plasmid
#196936)
-
PurposeTGFbeta reporter driven nuclear mCherry and CreERT2 with PGK driven rtTA3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePLKO
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
-
SpeciesSynthetic
- Promoter SBE
-
Tag
/ Fusion Protein
- P2A-CreERT2 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGATCTTGTCTTCGTTGGGAGTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SBE-NLS-mCherry-P2A-CreERT2 PGK-rtTA3 was a gift from Elaine Fuchs (Addgene plasmid # 196936 ; http://n2t.net/addgene:196936 ; RRID:Addgene_196936) -
For your References section:
TGF-beta promotes heterogeneity and drug resistance in squamous cell carcinoma. Oshimori N, Oristian D, Fuchs E. Cell. 2015 Feb 26;160(5):963-976. doi: 10.1016/j.cell.2015.01.043. 10.1016/j.cell.2015.01.043 PubMed 25723170