SBE-NLS-mCherry PGK-rtTA3
(Plasmid
#195332)
-
PurposeLentiviral construct of TGFβ reporter (nuclear mCherry) and hPGK driven rtTA3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 195332 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePLKO
-
Vector typeMammalian Expression, Lentiviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNLS-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)762
- Promoter miniCMV
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CTCGCTCAAAAGCTGGGAGT
- 3′ sequencing primer AGATCTTGTCTTCGTTGGGAGTGA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namertTA3
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter hPGK
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GTAGTGTGGGCCCTGTTCCTGCC
- 3′ sequencing primer AGCACAGCGGTATGACTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNaoki Oshimori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SBE-NLS-mCherry PGK-rtTA3 was a gift from Elaine Fuchs (Addgene plasmid # 195332 ; http://n2t.net/addgene:195332 ; RRID:Addgene_195332) -
For your References section:
Ras drives malignancy through stem cell crosstalk with the microenvironment. Yuan S, Stewart KS, Yang Y, Abdusselamoglu MD, Parigi SM, Feinberg TY, Tumaneng K, Yang H, Levorse JM, Polak L, Ng D, Fuchs E. Nature. 2022 Nov 30. doi: 10.1038/s41586-022-05475-6. 10.1038/s41586-022-05475-6 PubMed 36450983