Fragment1 with TLS2
(Plasmid
#196983)
-
PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepENTR4
- Total vector size (bp) 3032
-
Vector typeGateway-compatible entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntermediate fragment for assembly of gRNA-TLS2 construct
-
SpeciesA. thaliana (mustard weed); Streptococcus pyogenes
-
Insert Size (bp)765
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGCCATCCTGACGGATGGCC
- 3′ sequencing primer GGCCTCGACGTTTCCCGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please refer to the GO CRISP Cloning Protocol linked above for additional information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fragment1 with TLS2 was a gift from Friedrich Kragler (Addgene plasmid # 196983 ; http://n2t.net/addgene:196983 ; RRID:Addgene_196983) -
For your References section:
Heritable transgene-free genome editing in plants by grafting of wild-type shoots to transgenic donor rootstocks. Yang L, Machin F, Wang S, Saplaoura E, Kragler F. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01585-8. 10.1038/s41587-022-01585-8 PubMed 36593415