-
PurposeGateway-compatible gRNA backbone with TLS2 mobility signal. Template for the addition of target sequences to produce 2x graft-mobile gRNA-TLS2.
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute of Molecular Plant Physiology
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196983 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 196983-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 196983-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepENTR4
- Total vector size (bp) 3032
-
Vector typeGateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIntermediate fragment for assembly of gRNA-TLS2 construct
-
SpeciesA. thaliana (mustard weed); Streptococcus pyogenes
-
Insert Size (bp)765
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GGCCATCCTGACGGATGGCC
- 3′ sequencing primer GGCCTCGACGTTTCCCGTTG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please refer to the GO CRISP Cloning Protocol linked above for additional information.
DNA (Catalog # 196983-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 196983-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fragment1 with TLS2 was a gift from Friedrich Kragler (Addgene plasmid # 196983 ; http://n2t.net/addgene:196983 ; RRID:Addgene_196983) -
For your References section:
Heritable transgene-free genome editing in plants by grafting of wild-type shoots to transgenic donor rootstocks. Yang L, Machin F, Wang S, Saplaoura E, Kragler F. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01585-8. 10.1038/s41587-022-01585-8 PubMed 36593415
Map uploaded by the depositor.
