Fragment 1 Null
(Plasmid
#198729)
-
PurposeGateway-compatible gRNA backbone . Template for the addition of target sequences to produce 2x gRNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198729 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepENTR4
- Total vector size (bp) 2986
-
Vector typeGateway-compatible entry vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA expression cassette in pENTR4
-
SpeciesA. thaliana (mustard weed); Streptococcus pyogenes
-
Insert Size (bp)719
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGCCATCCTGACGGATGGCC
- 3′ sequencing primer GGCCTCGACGTTTCCCGTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please refer to the GO CRISP Cloning Protocol linked above for additional information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fragment 1 Null was a gift from Friedrich Kragler (Addgene plasmid # 198729 ; http://n2t.net/addgene:198729 ; RRID:Addgene_198729) -
For your References section:
Heritable transgene-free genome editing in plants by grafting of wild-type shoots to transgenic donor rootstocks. Yang L, Machin F, Wang S, Saplaoura E, Kragler F. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01585-8. 10.1038/s41587-022-01585-8 PubMed 36593415