Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSECRETS-A
(Plasmid #196986)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 196986 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBbA2c-RFP
  • Backbone size w/o insert (bp) 2800
  • Total vector size (bp) 7000
  • Modifications to backbone
    TetR placed under pAmp promoter
  • Vector type
    Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes Cas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4107
  • Promoter pltetO1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGCGAGTTTACGGGTTGTTA
  • 3′ sequencing primer AGTCACACTGGCTCACCTTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Vector: pBbA2c-RFP (Plasmid #35326); insert: pwtCas9-bacteria (Plasmid #44250); additional insert synthesized from IDT.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSECRETS-A was a gift from Eric Josephs (Addgene plasmid # 196986 ; http://n2t.net/addgene:196986 ; RRID:Addgene_196986)
  • For your References section:

    Selection of extended CRISPR RNAs with enhanced targeting and specificity. Herring-Nicholas A, Dimig H, Roesing MR, Josephs EA. Commun Biol. 2024 Jan 12;7(1):86. doi: 10.1038/s42003-024-05776-8. 10.1038/s42003-024-05776-8 PubMed 38212640