pLKO-TRE-AFOS
(Plasmid
#197079)
-
PurposeA doxycycline inducible dominant negative form of transcription complex AP1. AFOS heterodimerizes and inhibits c-Jun. Plasmid contains PGK driven H2B-RFP as a fluorescent reporter of transduction.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLKO
- Backbone size w/o insert (bp) 7659
- Total vector size (bp) 7960
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAFOS
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)301
-
Entrez GeneFos (a.k.a. D12Rfj1, c-fos, cFos)
- Promoter TRE
-
Tags
/ Fusion Proteins
- Flag (N terminal on insert)
- T7 (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCCATAGAAGACACCGGGAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid #33353 (CMV500 A-Fos)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-TRE-AFOS was a gift from Elaine Fuchs (Addgene plasmid # 197079 ; http://n2t.net/addgene:197079 ; RRID:Addgene_197079) -
For your References section:
Establishment, maintenance, and recall of inflammatory memory. Larsen SB, Cowley CJ, Sajjath SM, Barrows D, Yang Y, Carroll TS, Fuchs E. Cell Stem Cell. 2021 Oct 7;28(10):1758-1774.e8. doi: 10.1016/j.stem.2021.07.001. Epub 2021 Jul 27. 10.1016/j.stem.2021.07.001 PubMed 34320411