Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO-TRE-AFOS
(Plasmid #197079)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 197079 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO
  • Backbone size w/o insert (bp) 7659
  • Total vector size (bp) 7960
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    AFOS
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    301
  • Entrez Gene
    Fos (a.k.a. D12Rfj1, c-fos, cFos)
  • Promoter TRE
  • Tags / Fusion Proteins
    • Flag (N terminal on insert)
    • T7 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCCATAGAAGACACCGGGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene plasmid #33353 (CMV500 A-Fos)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO-TRE-AFOS was a gift from Elaine Fuchs (Addgene plasmid # 197079 ; http://n2t.net/addgene:197079 ; RRID:Addgene_197079)
  • For your References section:

    Establishment, maintenance, and recall of inflammatory memory. Larsen SB, Cowley CJ, Sajjath SM, Barrows D, Yang Y, Carroll TS, Fuchs E. Cell Stem Cell. 2021 Oct 7;28(10):1758-1774.e8. doi: 10.1016/j.stem.2021.07.001. Epub 2021 Jul 27. 10.1016/j.stem.2021.07.001 PubMed 34320411