pAcBac1-Mb-Fluoro-Phe D6
(Plasmid
#197577)
-
PurposeExpression of Methanosarcina barkeri (Mb) Fluoro-Phe D6 tRNA synthetase/Pyl-tRNA pair for the encoding of fluorinated phenylalanine derivatives at TAG codons in HEK293 cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAcBac1
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 10350
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameMb Pyl Fluoro-Phe B5 synthetase
-
SpeciesMethanosarcina barkeri
-
MutationN311A, C313M, V366G, W382T
- Promoter CMV
-
Tag
/ Fusion Protein
- Nuclear export sequence + FLAG (N terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePyl-tRNA (4 copies)
-
SpeciesMethanosarcina barkeri / Desulfitobacterium hafniens
- Promoter U6/H1
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer gtagccgaagatgacggtttgtc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcBac1-Mb-Fluoro-Phe D6 was a gift from Ryan Mehl (Addgene plasmid # 197577 ; http://n2t.net/addgene:197577 ; RRID:Addgene_197577) -
For your References section:
Tuning phenylalanine fluorination to assess aromatic contributions to protein function and stability in cells. Galles GD, Infield DT, Clark CJ, Hemshorn ML, Manikandan S, Fazan F, Rasouli A, Tajkhorshid E, Galpin JD, Cooley RB, Mehl RA, Ahern CA. Nat Commun. 2023 Jan 4;14(1):59. doi: 10.1038/s41467-022-35761-w. 10.1038/s41467-022-35761-w PubMed 36599844
