pLenti-hSyn1-eNpHR3.0-iRFP713
(Plasmid
#197594)
-
PurposeLentiviral transfer vector for the neuronal expression of eNpHR3.0-iRFP713 (halorhodopsin for the inhibition of neuronal activity)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197594 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 8479
- Total vector size (bp) 10411
-
Vector typeLentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeNpHR3.0-iRFP713
-
Insert Size (bp)1929
- Promoter hSynI
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer agtcgtgtcgtgcctgag
- 3′ sequencing primer TGTTGCTCCTTTTACGCTATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom Addgene's plasmid #47631
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hSyn1-eNpHR3.0-iRFP713 was a gift from Patrik Verstreken (Addgene plasmid # 197594 ; http://n2t.net/addgene:197594 ; RRID:Addgene_197594)