pLV-EF1a-AcGFP-P2A-hBRD4S
(Plasmid
#197882)
-
Purposestudy roles of human BET proteins in human pluripotency reprogramming
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 197882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLVH-EF1a-GFP-P2A
- Backbone size w/o insert (bp) 8317
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRD4
-
Alt nameBRD4S
-
Alt nameHUNK1
-
Alt nameMCAP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2169
-
GenBank IDNM_014299
-
Entrez GeneBRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AAGTACAACCCTCCTGACCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-EF1a-AcGFP-P2A-hBRD4S was a gift from Kejin Hu (Addgene plasmid # 197882 ; http://n2t.net/addgene:197882 ; RRID:Addgene_197882) -
For your References section:
Attenuating iPSC reprogramming stress with dominant-negative BET peptides. Hossain ME, Cevallos RR, Zhang R, Hu K. iScience. 2022 Dec 28;26(1):105889. doi: 10.1016/j.isci.2022.105889. eCollection 2023 Jan 20. 10.1016/j.isci.2022.105889 PubMed 36691621