pSUP-(2xCouRS-tRNAopt)
(Plasmid
#197930)
-
PurposeMachinery plasmid expressing constitutive and inducible 7HCou synthetase and cognate amber suppressing tRNA. Incorporates (7-hydroxy-4-coumarin-yl) ethylglycine
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 197930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSUP-(MjYRS-6TRN)
- Total vector size (bp) 6266
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCouRS
-
Alt name7-HCou Aminoacyl tRNA synthetase
-
Insert Size (bp)921
- Promoter glnS' and lambda(ts)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer GATTACGCGCAGACCAAAACGATC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametRNA opt
-
Insert Size (bp)77
- Promoter proK
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer cgcatctcgggcagcgttgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSUP-(2xCouRS-tRNAopt) was a gift from Kenneth Johnson (Addgene plasmid # 197930 ; http://n2t.net/addgene:197930 ; RRID:Addgene_197930) -
For your References section:
Optimized incorporation of an unnatural fluorescent amino acid affords measurement of conformational dynamics governing high-fidelity DNA replication. Dangerfield TL, Johnson KA. J Biol Chem. 2020 Dec 11;295(50):17265-17280. doi: 10.1074/jbc.RA120.015557. Epub 2020 Oct 5. 10.1074/jbc.RA120.015557 PubMed 33020184