pIBA2-Int-SpyTag
(Plasmid
#198038)
-
PurposeExpression plasmid for producing SpyTagged stalled secretion variant of intimin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198038 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepASK-IBA2
-
Backbone manufacturerIBA Lifescience
- Backbone size w/o insert (bp) 3286
- Total vector size (bp) 6229
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameeaeA
-
Alt nameintimin
-
SpeciesEscherichia coli
-
Insert Size (bp)2808
-
Mutationlacks native signal peptide (amino acids 1-39)
-
GenBank IDWP_000627890
- Promoter tet
-
Tag
/ Fusion Protein
- SpyTag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGTTATTTTACCACTCCCT
- 3′ sequencing primer CGCAGTAGCGGTAAACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMonika Schuetz, University Clinics Tuebingen, Tuebingen, Germany
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIBA2-Int-SpyTag was a gift from Jack Leo (Addgene plasmid # 198038 ; http://n2t.net/addgene:198038 ; RRID:Addgene_198038) -
For your References section:
Fluorescent Labeling of Outer Membrane Proteins Using the SpyCatcher-SpyTag System. Duodu R, Linke D, Leo JC. Methods Mol Biol. 2024;2778:53-63. doi: 10.1007/978-1-0716-3734-0_4. 10.1007/978-1-0716-3734-0_4 PubMed 38478271