p-mCherry2-sgRNA (empty)
(Plasmid
#198330)
-
PurposeCustomisable sgRNA sequence with optimised sgRNA scaffold for expression under U6 promoter, with mCherry2 reporter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemCherry2-C1
-
Backbone manufacturerAddgene 54563
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 5258
-
Modifications to backboneA cassette encoding sgRNA optimised (F+E) scaffold from //doi.org/10.1016/j.cell.2013.12.001 expressed under a human U6 promoter was inserted. An insertion site for custom sgRNA sequences has been included in the form of a buffer sequence flanked by BsmBI sites, allowing for scar-less introduction of your sgRNA seqeunce.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameU6-sgRNA(F+E) empty
-
Insert Size (bp)708
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer tacaccatcgtggaacagta
- 3′ sequencing primer gaggtgtgggaggtttttta (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Users should follow the oligo cloning protocol from the Zhang lab for plasmid lentiCRISPR v2 (Addgene #52961) to 1) remove stuffer fragment and 2) insert annealed oligos to complete gRNA.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p-mCherry2-sgRNA (empty) was a gift from Sarah McClelland (Addgene plasmid # 198330 ; http://n2t.net/addgene:198330 ; RRID:Addgene_198330) -
For your References section:
Targeted assembly of ectopic kinetochores to induce chromosome-specific segmental aneuploidies. Tovini L, Johnson SC, Guscott MA, Andersen AM, Spierings DCJ, Wardenaar R, Foijer F, McClelland SE. EMBO J. 2023 May 15;42(10):e111587. doi: 10.15252/embj.2022111587. Epub 2023 Apr 17. 10.15252/embj.2022111587 PubMed 37063065