pCI-neo-AP-4 (Myc)3-σ4
(Plasmid
#198331)
-
PurposeExpresses the triple Myc-tagged mouse AP-4 σ4 subunit in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 198331 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5474
- Total vector size (bp) 6018
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAP-4 σ4
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)578
-
Mutationsilent substitution in codon 131
- Promoter CMV
-
Tag
/ Fusion Protein
- triple Myc tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
- 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
(Myc)3 tag subcloned between XhoI and EcoRI sites; spacer and AP-4 σ4 subcloned between EcoRI and NotI sites (all sites preserved)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo-AP-4 (Myc)3-σ4 was a gift from Juan Bonifacino (Addgene plasmid # 198331 ; http://n2t.net/addgene:198331 ; RRID:Addgene_198331) -
For your References section:
The adaptor protein chaperone AAGAB stabilizes AP-4 complex subunits. Mattera R, De Pace R, Bonifacino JS. Mol Biol Cell. 2022 Oct 1;33(12):ar109. doi: 10.1091/mbc.E22-05-0177. Epub 2022 Aug 17. 10.1091/mbc.E22-05-0177 PubMed 35976721