Skip to main content

pTET2-lucCP
(Plasmid #198353)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198353 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Unknown
  • Backbone manufacturer
    Unknown
  • Backbone size w/o insert (bp) 5000
  • Total vector size (bp) 7048
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Species
    Firefly
  • Insert Size (bp)
    2347
  • Promoter pTET2

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer agcagagctcgtttagtgaacc
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Cloned by Jason Nathanson, Yeo Lab co-author on paper

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTET2-lucCP was a gift from Eugene Yeo (Addgene plasmid # 198353 ; http://n2t.net/addgene:198353 ; RRID:Addgene_198353)
  • For your References section:

    Large-scale tethered function assays identify factors that regulate mRNA stability and translation. Luo EC, Nathanson JL, Tan FE, Schwartz JL, Schmok JC, Shankar A, Markmiller S, Yee BA, Sathe S, Pratt GA, Scaletta DB, Ha Y, Hill DE, Aigner S, Yeo GW. Nat Struct Mol Biol. 2020 Oct;27(10):989-1000. doi: 10.1038/s41594-020-0477-6. Epub 2020 Aug 17. 10.1038/s41594-020-0477-6 PubMed 32807991