Skip to main content

N-terminal 3X Flag Human CASP9 C287A Mutant
(Plasmid #198380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198380 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4994
  • Total vector size (bp) 6349
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    N-Terminal 3X Flag Human Caspase-9 C287A Mutant
  • Alt name
    CASP-9; ICE-LAP6; Mch6; APAF-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1355
  • Mutation
    Changed Cysteine 287 to Alanine to eliminate protease activity
  • GenBank ID
    NM_001229
  • Entrez Gene
    CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3X Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (destroyed during cloning)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N-terminal 3X Flag Human CASP9 C287A Mutant was a gift from Hannah Rabinowich (Addgene plasmid # 198380 ; http://n2t.net/addgene:198380 ; RRID:Addgene_198380)
  • For your References section:

    Involvement of CASP9 (caspase 9) in IGF2R/CI-MPR endosomal transport. Han J, Goldstein LA, Hou W, Watkins SC, Rabinowich H. Autophagy. 2021 Jun;17(6):1393-1409. doi: 10.1080/15548627.2020.1761742. Epub 2020 May 25. 10.1080/15548627.2020.1761742 PubMed 32397873