Skip to main content

Human DsRed-Monomer CASP9 C287A Mutant
(Plasmid #198469)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198469 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDsRed-Monomer-Hyg-C1
  • Backbone manufacturer
    Takara Bio USA
  • Backbone size w/o insert (bp) 5685
  • Total vector size (bp) 6968
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Caspase-9 C287A Mutant
  • Alt name
    CASP-9; ICE-LAP6; Mch6; APAF-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1283
  • Mutation
    Changed Cysteine 287 to Alanine to eliminate protease activity
  • GenBank ID
    NM_001229
  • Entrez Gene
    CASP9 (a.k.a. APAF-3, APAF3, ICE-LAP6, MCH6, PPP1R56)
  • Promoter CMV
  • Tag / Fusion Protein
    • DsRed-monomer (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (not destroyed)
  • 3′ cloning site BamH I (not destroyed)
  • 5′ sequencing primer TACAAGGCCAAGAAGCCCGTG
  • 3′ sequencing primer GCTGATTATGATCAGTTATCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human DsRed-Monomer CASP9 C287A Mutant was a gift from Hannah Rabinowich (Addgene plasmid # 198469 ; http://n2t.net/addgene:198469 ; RRID:Addgene_198469)