pTopo_Ex2Donor_pPGK-PURO
(Plasmid
#198862)
-
PurposeDonor template for CRISPR/Cas9 targeting of TERT Ex2
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTOPO
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 5885
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; Bleomycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePURO
-
Insert Size (bp)2366
- Promoter PGK
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer GTGGCCCAGTGCCTGGTGT
- 3′ sequencing primer GAACCCAGAAAGATGGTCTCCAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTopo_Ex2Donor_pPGK-PURO was a gift from Agnel Sfeir (Addgene plasmid # 198862 ; http://n2t.net/addgene:198862 ; RRID:Addgene_198862) -
For your References section:
Single-Molecule Imaging of Telomerase RNA Reveals a Recruitment-Retention Model for Telomere Elongation. Laprade H, Querido E, Smith MJ, Guerit D, Crimmins H, Conomos D, Pourret E, Chartrand P, Sfeir A. Mol Cell. 2020 Jul 2;79(1):115-126.e6. doi: 10.1016/j.molcel.2020.05.005. Epub 2020 Jun 3. 10.1016/j.molcel.2020.05.005 PubMed 32497497