Skip to main content

pTopo_Ex2Donor_pPGK-PURO
(Plasmid #198862)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198862 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTOPO
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 5885
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418) ; Bleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PURO
  • Insert Size (bp)
    2366
  • Promoter PGK

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer GTGGCCCAGTGCCTGGTGT
  • 3′ sequencing primer GAACCCAGAAAGATGGTCTCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTopo_Ex2Donor_pPGK-PURO was a gift from Agnel Sfeir (Addgene plasmid # 198862 ; http://n2t.net/addgene:198862 ; RRID:Addgene_198862)
  • For your References section:

    Single-Molecule Imaging of Telomerase RNA Reveals a Recruitment-Retention Model for Telomere Elongation. Laprade H, Querido E, Smith MJ, Guerit D, Crimmins H, Conomos D, Pourret E, Chartrand P, Sfeir A. Mol Cell. 2020 Jul 2;79(1):115-126.e6. doi: 10.1016/j.molcel.2020.05.005. Epub 2020 Jun 3. 10.1016/j.molcel.2020.05.005 PubMed 32497497