pBMN_HA-TBK1 (kinase dead - D135N)
(Plasmid
#199206)
-
PurposeUsed for the expression of TBK1 carrying a kinase dead mutation D135N (SMC Internal No. 1997)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199206 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBMN
- Backbone size w/o insert (bp) 5029
- Total vector size (bp) 7216
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTBK1
-
Alt nameNF-kappa-B-activating kinase
-
Alt nameT2K
-
Alt nameNAK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2187
-
MutationD135N
-
GenBank IDAF191838
-
Entrez GeneTBK1 (a.k.a. FTDALS4, IIAE8, NAK, T2K)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATGGTATAGTGCACCGTAATATCAAGCCAGGAAAT
- 3′ sequencing primer TCCTAAAGACAGTCAACGTTGCGAAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.08.14.503930v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBMN_HA-TBK1 (kinase dead - D135N) was a gift from Sascha Martens (Addgene plasmid # 199206 ; http://n2t.net/addgene:199206 ; RRID:Addgene_199206) -
For your References section:
Unconventional initiation of PINK1/Parkin mitophagy by Optineurin. Nguyen TN, Sawa-Makarska J, Khuu G, Lam WK, Adriaenssens E, Fracchiolla D, Shoebridge S, Bernklau D, Padman BS, Skulsuppaisarn M, Lindblom RSJ, Martens S, Lazarou M. Mol Cell. 2023 May 18;83(10):1693-1709.e9. doi: 10.1016/j.molcel.2023.04.021. 10.1016/j.molcel.2023.04.021 PubMed 37207627