Skip to main content

pCAG-eSpCas9_sgAAVS1
(Plasmid #199213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199213 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    eSpCas9(1.1)
  • Backbone manufacturer
    Feng Zhang lab
  • Backbone size w/o insert (bp) 8482
  • Total vector size (bp) 8506
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAVS1-gRNA
  • Species
    Synthetic
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ttttgctggccttttgctca
  • 3′ sequencing primer tctgcagacaaatggctcta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-eSpCas9_sgAAVS1 was a gift from Gabor Balazsi (Addgene plasmid # 199213 ; http://n2t.net/addgene:199213 ; RRID:Addgene_199213)
  • For your References section:

    Nonmonotone invasion landscape by noise-aware control of metastasis activator levels. Wan Y, Cohen J, Szenk M, Farquhar KS, Coraci D, Krzyszton R, Azukas J, Van Nest N, Smashnov A, Chern YJ, De Martino D, Nguyen LC, Bien H, Bravo-Cordero JJ, Chan CH, Rosner MR, Balazsi G. Nat Chem Biol. 2023 Jul;19(7):887-899. doi: 10.1038/s41589-023-01344-z. Epub 2023 May 25. 10.1038/s41589-023-01344-z PubMed 37231268