pTP924 pHAGE2 CMV GFP
(Plasmid
#199392)
-
PurposeLentiviral transfer plasmid for constitutive expression of a GFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199392 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHAGE2
- Backbone size w/o insert (bp) 6404
- Total vector size (bp) 7094
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)690
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GTTGCCTGACAACGGGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTP924 pHAGE2 CMV GFP was a gift from Rebecca Voorhees (Addgene plasmid # 199392 ; http://n2t.net/addgene:199392 ; RRID:Addgene_199392) -
For your References section:
A nanobody-based strategy for rapid and scalable purification of human protein complexes. Stevens TA, Tomaleri GP, Hazu M, Wei S, Nguyen VN, DeKalb C, Voorhees RM, Pleiner T. Nat Protoc. 2024 Jan;19(1):127-158. doi: 10.1038/s41596-023-00904-w. Epub 2023 Nov 16. 10.1038/s41596-023-00904-w PubMed 37974029