Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMDC32B-BS-AtMIR390a-B/c
(Plasmid #199560)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199560 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMDC32
  • Backbone size w/o insert (bp) 10133
  • Total vector size (bp) 11629
  • Vector type
    RNAi
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Basal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites
  • Alt name
    BS-AtMIR390a-B/c
  • Alt name
    MIR390a
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1496
  • GenBank ID
    AT2G38325
  • Entrez Gene
    MIR390a (a.k.a. AT2G38325, MICRORNA 390, MIR390, MIR390A, microRNA390A, p_MI0001000)
  • Promoter 2x35S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer attB1 (ACAAGTTTGTACAAAAAAGCAGGCT)
  • 3′ sequencing primer attB2 (ACCACTTTGTACAAGAAAGCTGGGT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMDC32B-BS-AtMIR390a-B/c was a gift from Alberto Carbonell (Addgene plasmid # 199560 ; http://n2t.net/addgene:199560 ; RRID:Addgene_199560)
  • For your References section:

    Transgene-free, virus-based gene silencing in plants by artificial microRNAs derived from minimal precursors. Cisneros AE, Martin-Garcia T, Primc A, Kuziuta W, Sanchez-Vicente J, Aragones V, Daros JA, Carbonell A. Nucleic Acids Res. 2023 Oct 27;51(19):10719-10736. doi: 10.1093/nar/gkad747. 10.1093/nar/gkad747 PubMed 37713607