pMDC32B-BS-AtMIR390a-B/c
(Plasmid
#199560)
-
PurposePlant expression vector (2x35S) for direct cloning of amiRNAs into Arabidopsis thaliana MIR390a precursor including only the basal stem
-
Depositing Lab
-
Depositing OrganizationInstituto de Biologia Molecular y Celular de Plantas
Located in Spain -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMDC32
- Backbone size w/o insert (bp) 10133
- Total vector size (bp) 11629
-
Vector typeRNAi
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBasal stem of Arabidopsis MIR390a precursor including a chloramphenicol-ccdB cassette flanked by two inverted BsaI sites
-
Alt nameBS-AtMIR390a-B/c
-
Alt nameMIR390a
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)1496
-
GenBank IDAT2G38325
-
Entrez GeneMIR390a (a.k.a. AT2G38325, MICRORNA 390, MIR390, MIR390A, microRNA390A, p_MI0001000)
- Promoter 2x35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer attB1 (ACAAGTTTGTACAAAAAAGCAGGCT)
- 3′ sequencing primer attB2 (ACCACTTTGTACAAGAAAGCTGGGT)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMDC32B-BS-AtMIR390a-B/c was a gift from Alberto Carbonell (Addgene plasmid # 199560 ; http://n2t.net/addgene:199560 ; RRID:Addgene_199560) -
For your References section:
Transgene-free, virus-based gene silencing in plants by artificial microRNAs derived from minimal precursors. Cisneros AE, Martin-Garcia T, Primc A, Kuziuta W, Sanchez-Vicente J, Aragones V, Daros JA, Carbonell A. Nucleic Acids Res. 2023 Oct 27;51(19):10719-10736. doi: 10.1093/nar/gkad747. 10.1093/nar/gkad747 PubMed 37713607