pGEX-4T1_4xUb
(Plasmid
#199779)
-
PurposeUsed for the expression of 4X human ubiquitin in tandem (SMC interal no. 538)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199779 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX-4T1
- Backbone size w/o insert (bp) 300
- Total vector size (bp) 982
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name4X Ubiquitin in Tandem
-
SpeciesH. sapiens (human)
-
Insert Size (bp)691
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCAGGAATTCATATGCAGATC
- 3′ sequencing primer AAGATCTGCATGCCACCTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-4T1_4xUb was a gift from Sascha Martens (Addgene plasmid # 199779 ; http://n2t.net/addgene:199779 ; RRID:Addgene_199779) -
For your References section:
Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. Wurzer B, Zaffagnini G, Fracchiolla D, Turco E, Abert C, Romanov J, Martens S. Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941. 10.7554/eLife.08941 PubMed 26413874