pGEX-4T1_4xUb
(Plasmid #199779)

• Purpose: Used for the expression of 4X human ubiquitin in tandem (SMC interal no. 538)
• Depositing Lab: Sascha Martens
• Publication: Wurzer et al Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941.

Backbone

• Vector backbone: pGEX-4T1
• Backbone size w/o insert (bp): 300
• Total vector size (bp): 982
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: 4X Ubiquitin in Tandem
• Species: H. sapiens (human)
• Insert Size (bp): 691
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CCAGGAATTCATATGCAGATC
• 3′ sequencing primer: AAGATCTGCATGCCACCTCT

Resource Information

• Supplemental Documents:
  • SMc538_GST-4xUB_SMP358.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry