pAureus-TnCAM
(Plasmid
#199807)
-
Purposevector for transposome-mediated saturation mutagenesis and Tn-Seq in S. aureus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199807 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepuc19
- Backbone size w/o insert (bp) 2686
- Total vector size (bp) 3806
-
Modifications to backboneAddition of a synthetic transposon cassette enabling transposome-mediated saturation mutagenesis in S. aureus. The transposon cassette is flanked by mosaic end sequences recognized by Tn5 transposase, and contains a cat194 chloramphenicol resistance gene driven by the constitutive sarA promoter and sodB ribosome binding site. A bidirectional blaZ transcriptional terminator downstream of the resistance cassette limits polar effects from read-through transcription of adjacent genes and interference of resistance gene expression from opposing transcripts in the bacterial genome.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametransposon cassette
-
SpeciesS. aureus
-
Insert Size (bp)1120
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KasI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AGGCCTAATGACTGGCTTTT
- 3′ sequencing primer TGGCTAGTGCGTAGTCGTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See source publication for detailed protocols describing this vector's use.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAureus-TnCAM was a gift from Steve Salipante (Addgene plasmid # 199807 ; http://n2t.net/addgene:199807 ; RRID:Addgene_199807) -
For your References section:
Transposon sequencing identifies genes impacting Staphylococcus aureus invasion in a human macrophage model. Lo H-Y, Long DR, Holmes EA, Penewit K, Hodgson T, Lewis JD, Waalkes A, Salipante SJ. Infect Immun. 2023 Oct 17;91(10):e0022823. doi: 10.1128/iai.00228-23. Epub 2023 Sep 7. 10.1128/iai.00228-23 PubMed 37676013