Skip to main content

pAureus-TnCAM
(Plasmid #199807)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199807 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    puc19
  • Backbone size w/o insert (bp) 2686
  • Total vector size (bp) 3806
  • Modifications to backbone
    Addition of a synthetic transposon cassette enabling transposome-mediated saturation mutagenesis in S. aureus. The transposon cassette is flanked by mosaic end sequences recognized by Tn5 transposase, and contains a cat194 chloramphenicol resistance gene driven by the constitutive sarA promoter and sodB ribosome binding site. A bidirectional blaZ transcriptional terminator downstream of the resistance cassette limits polar effects from read-through transcription of adjacent genes and interference of resistance gene expression from opposing transcripts in the bacterial genome.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    transposon cassette
  • Species
    S. aureus
  • Insert Size (bp)
    1120

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KasI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer AGGCCTAATGACTGGCTTTT
  • 3′ sequencing primer TGGCTAGTGCGTAGTCGTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See source publication for detailed protocols describing this vector's use.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAureus-TnCAM was a gift from Steve Salipante (Addgene plasmid # 199807 ; http://n2t.net/addgene:199807 ; RRID:Addgene_199807)
  • For your References section:

    Transposon sequencing identifies genes impacting Staphylococcus aureus invasion in a human macrophage model. Lo H-Y, Long DR, Holmes EA, Penewit K, Hodgson T, Lewis JD, Waalkes A, Salipante SJ. Infect Immun. 2023 Oct 17;91(10):e0022823. doi: 10.1128/iai.00228-23. Epub 2023 Sep 7. 10.1128/iai.00228-23 PubMed 37676013