Skip to main content

pDM002-sgRNA-lenti-ZeoR
(Plasmid #200060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMCB320, bleomycin resistance marker is in place of puromycin resistance
  • Backbone size w/o insert (bp) 8668
  • Total vector size (bp) 8668
  • Modifications to backbone
    bleomycin resistance marker is in place of puromycin resistance
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bleomycin resistance, mCherry
  • gRNA/shRNA sequence
    GACCAGGATGGGCACCACCC
  • Promoter mU6

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pDM002 is modified from pMCB320 (Addgene #89359) from the Bassik lab, where puromycin resistance has been swapped out for zeocin resistance.

Please visit https://doi.org/10.1101/2023.01.29.526158 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDM002-sgRNA-lenti-ZeoR was a gift from Britt Glaunsinger (Addgene plasmid # 200060 ; http://n2t.net/addgene:200060 ; RRID:Addgene_200060)
  • For your References section:

    The viral packaging motor potentiates Kaposi's sarcoma-associated herpesvirus gene expression late in infection. McCollum CO, Didychuk AL, Liu D, Murray-Nerger LA, Cristea IM, Glaunsinger BA. PLoS Pathog. 2023 Apr 17;19(4):e1011163. doi: 10.1371/journal.ppat.1011163. eCollection 2023 Apr. 10.1371/journal.ppat.1011163 PubMed 37068108