-
Purpose3rd generation lentiviral sgRNA expression vector with mCherry, puromycin resistance, BlpI+BstXI cloning sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMCB306; mCherry is in place of GFP
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepuromycin resistance, mCherry
-
gRNA/shRNA sequenceGACCAGGATGGGCACCACCC
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pMCB320 is modified from pMCB306, which was originally derived from pU6-sgGFP-NT1 (addgene #46914) from the Weissman and Qi labs
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCB320 was a gift from Michael Bassik (Addgene plasmid # 89359 ; http://n2t.net/addgene:89359 ; RRID:Addgene_89359) -
For your References section:
Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactions. Han K, Jeng EE, Hess GT, Morgens DW, Li A, Bassik MC. Nat Biotechnol. 2017 Mar 20. doi: 10.1038/nbt.3834. 10.1038/nbt.3834 PubMed 28319085