WT WWP1
(Plasmid
#200085)
-
PurposeWWP1 in pQCXIN vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200085 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepQCXIN
-
Backbone manufacturerClonTech
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 10135
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameWT WWP1
-
SpeciesH. sapiens (human)
-
GenBank IDNM_007013.4
-
Entrez GeneWWP1 (a.k.a. AIP5, Tiul1, hSDRP1)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AACCGTCAGATCGCCTGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
WT WWP1 was a gift from Jason MacGurn (Addgene plasmid # 200085 ; http://n2t.net/addgene:200085 ; RRID:Addgene_200085) -
For your References section:
Lysosomal trafficking of the glucose transporter GLUT1 requires sequential regulation by TXNIP and ubiquitin. Qualls-Histed SJ, Nielsen CP, MacGurn JA. iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106150 PubMed 36890792