Skip to main content

WT Nedd4L
(Plasmid #200086)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200086 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pQCXIN
  • Backbone manufacturer
    ClonTech
  • Backbone size w/o insert (bp) 7181
  • Total vector size (bp) 10118
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nedd4L
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2748
  • GenBank ID
    NM_001144965.2
  • Entrez Gene
    NEDD4L (a.k.a. NEDD4-2, NEDD4.2, PVNH7, RSP5, hNEDD4-2)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer AACCGTCAGATCGCCTGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WT Nedd4L was a gift from Jason MacGurn (Addgene plasmid # 200086 ; http://n2t.net/addgene:200086 ; RRID:Addgene_200086)
  • For your References section:

    Lysosomal trafficking of the glucose transporter GLUT1 requires sequential regulation by TXNIP and ubiquitin. Qualls-Histed SJ, Nielsen CP, MacGurn JA. iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106150 PubMed 36890792