TXNIP-py
(Plasmid
#200090)
-
PurposeDox-inducible human TXNIP with py motif mutations (ppcy,ppty -->paca,pata) in pInducer20 vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepINDUCER20
- Backbone size w/o insert (bp) 11794
- Total vector size (bp) 11380
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTXNIP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1174
-
Mutationpy motifs mutated (aa331-334 and 375-378)
-
GenBank IDNM_001313972.2
-
Entrez GeneTXNIP (a.k.a. ARRDC6, EST01027, HHCPA78, THIF, VDUP1)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGAGCTCGTTTAGTGAACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TXNIP-py was a gift from Jason MacGurn (Addgene plasmid # 200090 ; http://n2t.net/addgene:200090 ; RRID:Addgene_200090) -
For your References section:
Lysosomal trafficking of the glucose transporter GLUT1 requires sequential regulation by TXNIP and ubiquitin. Qualls-Histed SJ, Nielsen CP, MacGurn JA. iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106150 PubMed 36890792