PC1-29-9-2_GAL4-VHL
(Plasmid
#200434)
-
PurposeExpresses the GAL4 DNA Binding domain linked to the VHL E3 Ubiquitin Ligase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCustom
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAL4-VHL
-
SpeciesSynthetic
-
Insert Size (bp)1108
-
Tag
/ Fusion Protein
- GAL4, VHL
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGCAACGTGCTGGTTATTGTGC
- 3′ sequencing primer CTCCTCAGGTGCAGGCTGCCTA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PC1-29-9-2_GAL4-VHL was a gift from Xue Gao (Addgene plasmid # 200434 ; http://n2t.net/addgene:200434 ; RRID:Addgene_200434) -
For your References section:
Engineered PROTAC-CID Systems for Mammalian Inducible Gene Regulation. Ma D, Yuan Q, Peng F, Paredes V, Zeng H, Osikpa EC, Yang Q, Peddi A, Patel A, Liu MS, Sun Z, Gao X. J Am Chem Soc. 2023 Jan 25;145(3):1593-1606. doi: 10.1021/jacs.2c09129. Epub 2023 Jan 10. 10.1021/jacs.2c09129 PubMed 36626587