pLenti-mSstr3-EGFP
(Plasmid
#200444)
-
PurposeLentiviral expression of mouse Sstr3-EGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEF1α-IRES-EGFP
- Backbone size w/o insert (bp) 9859
- Total vector size (bp) 11147
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSstr3
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1288
-
Entrez GeneSstr3 (a.k.a. Smstr-3, Smstr3, sst3)
- Promoter EF1 alpha
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer TTCTCAAGCCTCAGACAGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-mSstr3-EGFP was a gift from Ken-Ichi Takemaru (Addgene plasmid # 200444 ; http://n2t.net/addgene:200444 ; RRID:Addgene_200444)