Skip to main content
Addgene

pGMC00028 (aka pTS0057)
(Plasmid #200832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200832 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene-73797 - lenti sgRNA(MS2)_puro optimized backbone
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AAVS1 guide RNA
  • gRNA/shRNA sequence
    GTCCCCTCCACCCCACAGTG
  • Species
    H. sapiens (human)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGMC00028 (aka pTS0057) was a gift from Raj Chari (Addgene plasmid # 200832 ; http://n2t.net/addgene:200832 ; RRID:Addgene_200832)
  • For your References section:

    Uncovering receptor-ligand interactions using a high-avidity CRISPR activation screening platform. Yang L, Sheets TP, Feng Y, Yu G, Bajgain P, Hsu KS, So D, Seaman S, Lee J, Lin L, Evans CN, Guest MR, Chari R, St Croix B. Sci Adv. 2024 Feb 16;10(7):eadj2445. doi: 10.1126/sciadv.adj2445. Epub 2024 Feb 14. 10.1126/sciadv.adj2445 PubMed 38354234