pGMC00028 (aka pTS0057)
(Plasmid
#200832)
-
PurposeAAVS1 guide RNA cloned into the lentiSAM puro backbone
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAddgene-73797 - lenti sgRNA(MS2)_puro optimized backbone
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1 guide RNA
-
gRNA/shRNA sequenceGTCCCCTCCACCCCACAGTG
-
SpeciesH. sapiens (human)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGMC00028 (aka pTS0057) was a gift from Raj Chari (Addgene plasmid # 200832 ; http://n2t.net/addgene:200832 ; RRID:Addgene_200832) -
For your References section:
Uncovering receptor-ligand interactions using a high-avidity CRISPR activation screening platform. Yang L, Sheets TP, Feng Y, Yu G, Bajgain P, Hsu KS, So D, Seaman S, Lee J, Lin L, Evans CN, Guest MR, Chari R, St Croix B. Sci Adv. 2024 Feb 16;10(7):eadj2445. doi: 10.1126/sciadv.adj2445. Epub 2024 Feb 14. 10.1126/sciadv.adj2445 PubMed 38354234