CMV-synaptophysin-Lime
(Plasmid
#201016)
-
PurposeExpresses Lime in synaptic vesicle lumen by fusion to synaptophysin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201016 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDNA3
- Total vector size (bp) 6780
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynaptophysin-Lime
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1728
-
Entrez GeneSyp (a.k.a. A230093K24Rik, Syn, p38)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-synaptophysin-Lime was a gift from Jaime de Juan-Sanz (Addgene plasmid # 201016 ; http://n2t.net/addgene:201016 ; RRID:Addgene_201016) -
For your References section:
Rational Engineering of an Improved Genetically Encoded pH Sensor Based on Superecliptic pHluorin. Shen Y, Wen Y, Sposini S, Vishwanath AA, Abdelfattah AS, Schreiter ER, Lemieux MJ, de Juan-Sanz J, Perrais D, Campbell RE. ACS Sens. 2023 Aug 25;8(8):3014-3022. doi: 10.1021/acssensors.3c00484. Epub 2023 Jul 23. 10.1021/acssensors.3c00484 PubMed 37481776