pAAV-TRE3_ mTFP1- Vamp2
(Plasmid #201214)

• Purpose: AAV expression of TRE(TRE3G)-driven, Vamp2-conjugated mTFP1 expression for fluorescent labling of axon terminals
• Depositing Lab: Tetsuo Yamamori
• Publication: Watakabe et al Neuron. 2023 May 9:S0896-6273(23)00338-0. doi: 10.1016/j.neuron.2023.04.028.

Backbone

• Vector backbone: pAAV-TRE-flex-Clover
• Backbone manufacturer: addgene Plasmid #135177
• Modifications to backbone: Replacement of flex-clover insert with mTFP-Vamp2 (WPRE is retained)
• Vector type: Mammalian Expression, Bacterial Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mTFP1 (from addgene #54613)
• Species: Clavularia sp.
• Promoter: TRE3G
• Tag / Fusion Protein:
  • mouse Vamp2 (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: GGCATTAAAGCAGCGTATCC

Resource Information

• Supplemental Documents:
  • pAAV-TRE3Gpro-N-mTFP1.0-mVamp2-WPRE-polyA.ape

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.