pAAV-TRE3_ mTFP1- Vamp2
(Plasmid
#201214)
-
PurposeAAV expression of TRE(TRE3G)-driven, Vamp2-conjugated mTFP1 expression for fluorescent labling of axon terminals
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201214 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-TRE-flex-Clover
-
Backbone manufactureraddgene Plasmid #135177
-
Modifications to backboneReplacement of flex-clover insert with mTFP-Vamp2 (WPRE is retained)
-
Vector typeMammalian Expression, Bacterial Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTFP1 (from addgene #54613)
-
SpeciesClavularia sp.
- Promoter TRE3G
-
Tag
/ Fusion Protein
- mouse Vamp2 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer GGCATTAAAGCAGCGTATCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2021.12.26.474213 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-TRE3_ mTFP1- Vamp2 was a gift from Tetsuo Yamamori (Addgene plasmid # 201214 ; http://n2t.net/addgene:201214 ; RRID:Addgene_201214) -
For your References section:
Local and long-distance organization of prefrontal cortex circuits in the marmoset brain. Watakabe A, Skibbe H, Nakae K, Abe H, Ichinohe N, Rachmadi MF, Wang J, Takaji M, Mizukami H, Woodward A, Gong R, Hata J, Van Essen DC, Okano H, Ishii S, Yamamori T. Neuron. 2023 May 9:S0896-6273(23)00338-0. doi: 10.1016/j.neuron.2023.04.028. 10.1016/j.neuron.2023.04.028 PubMed 37196659