Skip to main content

PB-TAC-ERP2-(N-HA)KRAS_G12D
(Plasmid #201254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201254 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PB-TAC-ERP2
  • Backbone manufacturer
    Knut Woltjen, Addgene plasmid #80478
  • Backbone size w/o insert (bp) 10723
  • Total vector size (bp) 11347
  • Modifications to backbone
    None
  • Vector type
    Mammalian Expression ; piggyBac transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAS
  • Alt name
    Kirsten rat sarcoma viral oncogene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    624
  • Mutation
    changed Gly (G) 12 to Asp (D)
  • GenBank ID
    NM_001369787.1 NM_004985.5
  • Entrez Gene
    KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
  • Promoter TRE
  • Tag / Fusion Protein
    • HA-Tag (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer aaaaagcaggcttcactagtgtctttcataagcttatgtatccatatgatgtgcccgact
  • 3′ sequencing primer agaaagctgggtgtgacacacattccacagggt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pBABE-KRAS G12D, Addgene 58902, Channing Der lab

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-TAC-ERP2-(N-HA)KRAS_G12D was a gift from Alexander Kleger (Addgene plasmid # 201254 ; http://n2t.net/addgene:201254 ; RRID:Addgene_201254)
  • For your References section:

    Modeling plasticity and dysplasia of pancreatic ductal organoids derived from human pluripotent stem cells. Breunig M, Merkle J, Wagner M, Melzer MK, Barth TFE, Engleitner T, Krumm J, Wiedenmann S, Cohrs CM, Perkhofer L, Jain G, Kruger J, Hermann PC, Schmid M, Madacsy T, Varga A, Griger J, Azoitei N, Muller M, Wessely O, Robey PG, Heller S, Dantes Z, Reichert M, Gunes C, Bolenz C, Kuhn F, Maleth J, Speier S, Liebau S, Sipos B, Kuster B, Seufferlein T, Rad R, Meier M, Hohwieler M, Kleger A. Cell Stem Cell. 2021 Jun 3;28(6):1105-1124.e19. doi: 10.1016/j.stem.2021.03.005. Epub 2021 Apr 28. 10.1016/j.stem.2021.03.005 PubMed 33915078