Skip to main content

pJM919_WT His POLI
(Plasmid #201444)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201444 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJM868
  • Total vector size (bp) 7631
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    DNA polymerase iota
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2148
  • Mutation
    Coding sequence has been optimised for expression in E. coli
  • Entrez Gene
    POLI (a.k.a. RAD30B, RAD3OB, eta2)
  • Promoter lacIq
  • Tag / Fusion Protein
    • 6x His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer GCAGCAGCCATCATCATCATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM919_WT His POLI was a gift from Roger Woodgate (Addgene plasmid # 201444 ; http://n2t.net/addgene:201444 ; RRID:Addgene_201444)
  • For your References section:

    A novel interaction between RAD23A/B and Y-family DNA polymerases. Ashton NW, Jaiswal N, Cestari Moreno N, Semenova IV, D'Orlando DA, Teatin Latancia M, McIntyre J, Woodgate R, Bezsonova I. J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353. 10.1016/j.jmb.2023.168353 PubMed 37935254