EGFP in pDBEcR-pIND(SP1)/Bla
(Plasmid
#201557)
-
PurposeEcdysone-inducible vector with SB ITRs for expressing DBEcR (3xmyc- tagged) and FLAG- EGFP; blasticidin resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDBEcR/Bla
- Total vector size (bp) 8039
-
Vector typeMammalian Expression, Unspecified ; sleeping beauty transposon
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDBEcR and EGFP
-
Speciesa hybrid Drosophila/Bombyx ecdysone receptor
- Promoter EF1a and pIMD(SP1)
-
Tags
/ Fusion Proteins
- DBEcR-myc (C terminal on insert)
- FLAG-EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer 5'-AGCCTCTAGGGTCGACCTCGACGGAT-3'
- 3′ sequencing primer CCTGCACCTGAGGAGTGAATTCTTATCATGTCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP in pDBEcR-pIND(SP1)/Bla was a gift from Randy Poon (Addgene plasmid # 201557 ; http://n2t.net/addgene:201557 ; RRID:Addgene_201557) -
For your References section:
A robust dual gene ON-OFF toggle directed by two independent promoter-degron pairs. Yeung TK, Kim S, Ma HT, Poon RYC. J Cell Sci. 2023 Apr 15;136(8):jcs260754. doi: 10.1242/jcs.260754. Epub 2023 Apr 19. 10.1242/jcs.260754 PubMed 36995025