Skip to main content

pLenti-hSFTPCpromoter(2kb)-EGFP-EF1a-TagRFP
(Plasmid #201681)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201681 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE
  • Backbone size w/o insert (bp) 8196
  • Total vector size (bp) 10441
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    SFTPC promoter region (2kb upstream)
  • Species
    H. sapiens (human); Homo sapiens
  • Insert Size (bp)
    2235
  • GenBank ID
    NC_000008.11

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tagcggccacagagcttgtgacagc
  • 3′ sequencing primer ctgcaggtgctatgctctcctctcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TagRFP
  • Insert Size (bp)
    714

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.08.30.555522 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-hSFTPCpromoter(2kb)-EGFP-EF1a-TagRFP was a gift from Emma Rawlins (Addgene plasmid # 201681 ; http://n2t.net/addgene:201681 ; RRID:Addgene_201681)
  • For your References section:

    A novel human fetal lung-derived alveolar organoid model reveals mechanisms of surfactant protein C maturation relevant to interstitial lung disease. Lim K, Rutherford EN, Sun D, Van den Boomen DJH, Edgar JR, Bang JH, Matesic LE, Lee JH, Lehner PJ, Marciniak SJ, Rawlins EL, Dickens JA. bioRxiv [Preprint]. 2023 Sep 4:2023.08.30.555522. doi: 10.1101/2023.08.30.555522. 10.1101/2023.08.30.555522 PubMed 37693487